Question 1

All mature polypeptides contain a methionine at the N-terminus.

Accepted Answer

A) True 
 B)False

Question 2

Frequently, the start codon for the functional protein is not at the 5' end of the mRNA. In fact, there are often several codons 5' of the start codon in an edited mRNA prior to translation. What is the purpose of these codons in a eukaryotic system?

Accepted Answer

A)   Ribosomal binding sites
B)   Act as a promoter
C)   Serve as sorting or traffic signals for the ribosome
D)   Sites of spliceosome activity

Question 3

The one-gene, one-enzyme hypothesis was first proposed by Beadle and Tatum.

Accepted Answer

A) True 
 B)False

Question 4

The first person to suggest that a connection exists between the function of a gene and the production
of an enzyme was Archibald Garrod.

Accepted Answer

A) True 
 B)False  True

Question 5

Where does mRNA/tRNA codon-anticodon recognition take place?

Accepted Answer

A)   30S
B)   40S
C)   50S
D)   The surface between the two ribosomal subunits

Question 6

Which of the following codons is not degenerate to CUU?

Accepted Answer

A)   CUC
B)   UUG
C)   CUA
D)   AUU
E)   UUA

Question 7

Which of the following is true according to the adaptor hypothesis?

Accepted Answer

A)   The anticodon and amino acid have no relationship
B)   A given tRNA can carry any of the twenty amino acids
C)   tRNA binds to mRNA at the ribosome
D)   An amino acid recognizes the codon in mRNA

Question 8

The peptidyltransferase complex is a component of which of the following?

Accepted Answer

A)   DNA
B)   tRNA
C)   The ribosome
D)   The functional protein
E)   mRNA

Question 9

Where are the ribosomal subunits assembled?

Accepted Answer

A)   Nucleus
B)   Nucleoid
C)   Nucleolus
D)   Nuclear envelope

Question 10

RF1 and RF2 are active during .

Accepted Answer

A)   Initiation
B)   Elongation
C)   Termination
D)   Cotranslational import

Question 11

The C-terminal of a polypeptide always contains which of the following?

Accepted Answer

A)   A stop codon
B)   A carboxyl group
C)   An amino group
D)   Carbon dioxide
E)   None of the answers are correct

Question 12

The anticodon on the mRNA recognizes the codon on the tRNA.
FALSE

Accepted Answer

A) True 
 B)False

Question 13

The Shine-Dalgarno sequence is found in eukaryotic cells.

Accepted Answer

A) True 
 B)False  False

Question 14

How many polypeptides are coded for by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'

Accepted Answer

A)   7
B)   8
C)   10
D)   13

Question 15

a-helices and b-sheets are examples of what level of protein structure?

Accepted Answer

A)   Primary structure
B)   Secondary structure
C)   Tertiary structure
D)   Quanternary structure

Question 16

Proteins that are composed of two or more subunits or polypeptides are said the have quanternary
structure.

Accepted Answer

A) True 
 B)False

Question 17

The wobble base is usually associated with the second base of a codon.

Accepted Answer

A) True 
 B)False

Question 18

What is the modern theory of genetics?

Accepted Answer

A)   One gene-one enzyme
B)   One gene-one polypeptide
C)   One gene-various number of enzymes
D)   No relationship can be determined between genes and proteins

Question 19

The genetic code is universal in nuclear DNA from bacteria to mammals.

Accepted Answer

A) True 
 B)False

Question 20

Raney nickel converts cysteine to what?

Accepted Answer

A)   Glycine
B)   Asparagine
C)   Alanine
D)   Serine C

Exam 13: Translation of Mrna

All mature polypeptides contain a methionine at the N-terminus.

Correct AnswerverifiedShow Answer

Frequently, the start codon for the functional protein is not at the 5' end of the mRNA. In fact, there are often several codons 5' of the start codon in an edited mRNA prior to translation. What is the purpose of these codons in a eukaryotic system?

Correct AnswerverifiedShow Answer

The one-gene, one-enzyme hypothesis was first proposed by Beadle and Tatum.

Correct AnswerverifiedShow Answer

The first person to suggest that a connection exists between the function of a gene and the production of an enzyme was Archibald Garrod.

Correct AnswerverifiedTrue

Where does mRNA/tRNA codon-anticodon recognition take place?

Correct AnswerverifiedShow Answer

Which of the following codons is not degenerate to CUU?

Correct AnswerverifiedShow Answer

Which of the following is true according to the adaptor hypothesis?

Correct AnswerverifiedShow Answer

The peptidyltransferase complex is a component of which of the following?

Correct AnswerverifiedShow Answer

Where are the ribosomal subunits assembled?

Correct AnswerverifiedShow Answer

RF1 and RF2 are active during .

Correct AnswerverifiedShow Answer

The C-terminal of a polypeptide always contains which of the following?

Correct AnswerverifiedShow Answer

The anticodon on the mRNA recognizes the codon on the tRNA. FALSE

Correct AnswerverifiedShow Answer

The Shine-Dalgarno sequence is found in eukaryotic cells.

Correct AnswerverifiedFalse

How many polypeptides are coded for by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'

Correct AnswerverifiedShow Answer

a-helices and b-sheets are examples of what level of protein structure?

Correct AnswerverifiedShow Answer

Proteins that are composed of two or more subunits or polypeptides are said the have quanternary structure.

Correct AnswerverifiedShow Answer

The wobble base is usually associated with the second base of a codon.

Correct AnswerverifiedShow Answer

What is the modern theory of genetics?

Correct AnswerverifiedShow Answer

The genetic code is universal in nuclear DNA from bacteria to mammals.

Correct AnswerverifiedShow Answer

Raney nickel converts cysteine to what?

Correct AnswerverifiedC

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified
True

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified
False

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified
C