Question 1

The primary structure of a protein is directly associated with ______.

Accepted Answer

A)  regular repeating shapes, such as beta-sheets
B)  the three-dimensional shape of the protein
C)  the linear sequence of the amino acids
D)  the interaction of two or more peptide chains C

Question 2

What typically stops the process of translation?

Accepted Answer

A)  Rho proteins
B)  Aminoacyl tRNA synthase
C)  rRNA
D)  Stop codons
E)  Introns

Question 3

A polyribosome would be found in which of the following types of cells?

Accepted Answer

A)  Prokaryotic
B)  Eukaryotic
C)  Both

Question 4

A protein called actin consists of 376 amino acids. The mRNA for actin must be longer than

Accepted Answer

A)  125 nucleotides.
B)  376 nucleotides.
C)  1128 nucleotides.
D)  3384 nucleotides. C

Question 5

Where are the ribosomal subunits assembled in eukaryotes?

Accepted Answer

A)  Nucleus
B)  Nucleoid
C)  Nucleolus
D)  Nuclear envelope

Question 6

RF1 and RF2 are active during _______.

Accepted Answer

A)  initiation
B)  elongation
C)  termination
D)  peptidyl transfer

Question 7

A tRNA that has an amino acid attached is called _____.

Accepted Answer

A)  an rRNA
B)  a degenerate tRNA
C)  a coding tRNA
D)  a charged tRNA
E)  None of the answers are correct

Question 8

Consider the following mRNA from a eukaryotic species. Which AUG codon is translation most likely to begin from?
5'-CCUAUGAGCCACCAUGGAUGCCAAAUGCA-3'

Accepted Answer

A)  1st
B)  2nd
C)  3rd
D)  4th

Question 9

Select the codon that is not synonymous with CUU.

Accepted Answer

A)  CUC
B)  UUG
C)  CUA
D)  AUU
E)  UUA

Question 10

α\alphaα -helices and  β\betaβ  -sheets are examples of what level of protein structure?

Accepted Answer

A)  Primary structure
B)  Secondary structure
C)  Tertiary structure
D)  Quanternary structure

Question 11

61 different tRNAs are required for translation both in vivo and in vitro.

Accepted Answer

A) True 
 B)False

Question 12

How many amino acids would be included in the polypeptide encoded by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'

Accepted Answer

A)  7
B)  8
C)  10
D)  13

Question 13

What is the minimal number of tRNAs that can be used to recognize all of the codons for threonine?

Accepted Answer

A)  1
B)  2
C)  3
D)  4 B

Question 14

An anticodon is located on ______.

Accepted Answer

A)  DNA
B)  mRNA
C)  rRNA
D)  tRNA
E)  snRNA

Question 15

The genetic code is universal in nuclear DNA from bacteria to mammals.

Accepted Answer

A) True 
 B)False

Question 16

You perform a cell free translation experiment like Nirenberg and Matthaei. You start with 60% C and 40% A. What relative amount of radiolabeled proline do you expect in the translated polypeptides?

Accepted Answer

A)  36%
B)  22%
C)  14%
D)   28%

Question 17

The C-terminus of a polypeptide always contains

Accepted Answer

A)  a stop codon.
B)  a carboxyl group.
C)  an amino group.
D)  carbon dioxide.
E)   None of the answers are correct.

Question 18

In the digestive system of animals, proteins called amylases and proteases break down large molecules (for example, starches or proteins)  into smaller ones so that they can be absorbed by the intestine. What category of protein function do these proteins fall into?

Accepted Answer

A)  Cell shape or organization
B)  Transport
C)  Movement
D)  Cell signaling
E)  Cell surface recognitionF)  Enzymes

Question 19

Select the amino acid that has been activated by aminoacyl-tRNA synthetase.

Accepted Answer

A)  Amino acid · ATP · aminoacyl-tRNA synthetase
B)  Amino acid · aminoacyl-tRNA synthetase
C)  Amino acid + AMP + PPi
D)  Amino acid · AMP

Question 20

What is true according to the adaptor hypothesis?

Accepted Answer

A)  The anticodon and amino acid have no relationship.
B)  A given tRNA can carry any of the twenty amino acids.
C)  The position of an amino acid within a polypeptide is determined by the binding of mRNA with a tRNA carrying a specific amino acid.
D)  An amino acid recognizes the codon in mRNA.

Exam 13: Translation of MRNA

The primary structure of a protein is directly associated with ______.

Correct AnswerverifiedC

What typically stops the process of translation?

Correct AnswerverifiedShow Answer

A polyribosome would be found in which of the following types of cells?

Correct AnswerverifiedShow Answer

A protein called actin consists of 376 amino acids. The mRNA for actin must be longer than

Correct AnswerverifiedC

Where are the ribosomal subunits assembled in eukaryotes?

Correct AnswerverifiedShow Answer

RF1 and RF2 are active during _______.

Correct AnswerverifiedShow Answer

A tRNA that has an amino acid attached is called _____.

Correct AnswerverifiedShow Answer

Consider the following mRNA from a eukaryotic species. Which AUG codon is translation most likely to begin from? 5'-CCUAUGAGCCACCAUGGAUGCCAAAUGCA-3'

Correct AnswerverifiedShow Answer

Select the codon that is not synonymous with CUU.

Correct AnswerverifiedShow Answer

α\alphaα -helices and β\betaβ -sheets are examples of what level of protein structure?

Correct AnswerverifiedShow Answer

61 different tRNAs are required for translation both in vivo and in vitro.

Correct AnswerverifiedShow Answer

How many amino acids would be included in the polypeptide encoded by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'

Correct AnswerverifiedShow Answer

What is the minimal number of tRNAs that can be used to recognize all of the codons for threonine?

Correct AnswerverifiedB

An anticodon is located on ______.

Correct AnswerverifiedShow Answer

The genetic code is universal in nuclear DNA from bacteria to mammals.

Correct AnswerverifiedShow Answer

You perform a cell free translation experiment like Nirenberg and Matthaei. You start with 60% C and 40% A. What relative amount of radiolabeled proline do you expect in the translated polypeptides?

Correct AnswerverifiedShow Answer

The C-terminus of a polypeptide always contains

Correct AnswerverifiedShow Answer

In the digestive system of animals, proteins called amylases and proteases break down large molecules (for example, starches or proteins) into smaller ones so that they can be absorbed by the intestine. What category of protein function do these proteins fall into?

Correct AnswerverifiedShow Answer

Select the amino acid that has been activated by aminoacyl-tRNA synthetase.

Correct AnswerverifiedShow Answer

What is true according to the adaptor hypothesis?

Correct AnswerverifiedShow Answer

Correct Answer
verified
C

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified
C

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

$\alpha$ -helices and $\beta$ -sheets are examples of what level of protein structure?

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified
B

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified